You can't grow a virus on sterile plates. That approach would apply to some bacteria.
Brexit, for once some facts.
- Thread starter flecc
- Start date
he probably meant in lab conditions.
bits of SARS-COV-2 are added to VSV (vesicular stomatitis virus) for study.
It offers one possible explanation.
bits of SARS-COV-2 are added to VSV (vesicular stomatitis virus) for study.
It offers one possible explanation.
Does NOT mean it can grow or reproduce. Just that a sample in some way placed onto a surface, then taken from the surface proved some viability when cultured in, as Woosh said, VSV or whatever other technique.
Viruses depend on the activity of other living cells in order to reproduce. Hence, viruses cannot grow on sterile plates.
I was implying that taking a sample from these sewer washings,which were isolated last March and then introducing it into a growth medium ... Whether in vitro or in vivo or some hybrid growth medium ,and then generating viable viruses , would be a proof. Using the high amplification of rna code fragments is very noisy and is not reliable.
The process by which the viability of the CV19 virus on different surfaces was demonstrated was by placing a known titre on various substrates and then washing it off after known delays and then putting those washings into a growth medium and after another period of time allowing it to incubate, assaying the quantity of viruses produced.
If you had not expressly stated "sterile", I probably wouldn't even have noticed!
I know that there are very obvious differences between Wales and England, but I suspect many had missed that Wales could continue to restrict foreign travel while England allows it. Yes, I appreciate the five-mile limit could be interpreted as precluding travel to an airport!
No decision has been made on whether Wales will follow England and ease restrictions on non-essential overseas travel, the Welsh Government has said.
From 6 July people in England can travel to some European countries without having to spend 14 days in quarantine on their return.
Tourism in Wales is not due to re-open until the following week on 13 July.
The UK government is responsible for border controls, but health and the response to the pandemic is devolved.
This means any quarantine measures would need to be approved by the Welsh Government.
The UK Foreign Office advice against all but essential international travel has been in place since 17 March.
But under its new rules, a traffic light system will be introduced - with countries classified as green, amber or red depending on the prevalence of coronavirus. The UK is likely to discuss arrangements with countries over the coming days.
https://www.bbc.co.uk/news/uk-wales-53205969
No decision has been made on whether Wales will follow England and ease restrictions on non-essential overseas travel, the Welsh Government has said.
From 6 July people in England can travel to some European countries without having to spend 14 days in quarantine on their return.
Tourism in Wales is not due to re-open until the following week on 13 July.
The UK government is responsible for border controls, but health and the response to the pandemic is devolved.
This means any quarantine measures would need to be approved by the Welsh Government.
The UK Foreign Office advice against all but essential international travel has been in place since 17 March.
But under its new rules, a traffic light system will be introduced - with countries classified as green, amber or red depending on the prevalence of coronavirus. The UK is likely to discuss arrangements with countries over the coming days.
https://www.bbc.co.uk/news/uk-wales-53205969
the study relates to sample sewer water taken last year, before WHO was notified by the Chinese.
That's why the interest.
Anyway, samples are tested as is with RT-PCR for SARS-COV-2's signatures (IP2/IP4/E regions or genes).
The normal CV test schedule is contained in this WHO document:
Their study did something cleverer than just testing but just read the WHO document. My interest is whether it's a lab accident or natural mutations. People play with fire and all that..
The significance of real evidence of this virus circulating in many months earlier than its appearance in Wuhan in November is appreciated, but in the absence of any medical symptoms in that city , and what would have been mega diluted virus concentration in sewage ,makes the connection tenuous
There is no simple way for a new disease like Covid19 to attract medical attention before it kills (or make them seriously ill) several people in the same family.
it's like digital signatures, the diluted concentration is not an issue, they are well within the capability of our equipment.
Analogy.. were I to take an entire dictionary and look for the number of references to "expeladocious" ..or whatever Mary Poppins said. I might find only one reference. If I looked for any of the single letters e x p l d etc .. I would find a vast number , if I restricted my self to "ex " or" us " I would still find vast numbers ..and that is with 26 letters to play with only 4 , the number of false correlations grows enormously , unless the sequence is very long.
The sewage sludge is a soup of unbelievably complexity of molecules from all the dinners eaten and all the bacteria dropped from all the humans and animals in the city for decades .The smaller the fragments sought and the bigger the pool, the greater the chance of pucking up a marker.
But the key point is that if in the samples chosen, there was that much rna present, why would there not have been wide scale illness in February 2019?. ..
The diluted concentration does matter, because it relates to probability , not equipment sensitivity.
Each PCR cycle multiplies the segment we are looking for (if present) by 50 times. One, two or 3 cycles are usually sufficient to measure the amount.
Each sequence consists of about 20 amino bases plus directions (3' and 5')
such as this sequence in the IP2 region that is used for Covid test: AGATGTCTTGTGCTGCCGGTA - that's 4 to the power of 20, that is one in 1.09 trillion possibilities before you add the direction.
You then have 2 more like that, plus a positive and a negative test. To confirm a Covid case, you need all three genes. You run into 4 to the power of 50-70. Honestly, we don't have a problem with accidental identifications.
The issue we have is the incredible infectivity of this virus compared to its parents. Is it pure bad luck or man made?
Last edited:
Penfold strikes again
How can it be that Danger Mouse's dumb assistant is dumb enough to stick his little sticky nose it when and where it doesn't belong?
How can it be that Danger Mouse's dumb assistant is dumb enough to stick his little sticky nose it when and where it doesn't belong?
How will the ECJ be avoided wrt NI?Penfold strikes again
How can it be that Danger Mouse's dumb assistant is dumb enough to stick his little sticky nose it when and where it doesn't belong?
Flu virus with 'pandemic potential' found in China
The new strain, scientists say, is carried by pigs but can infect humans and requires close monitoring.
www.bbc.co.uk
How To Cook the Best Bacon Sandwich - Korean Style!
What condiments go with a bacon sandwich? If there’s one thing better than a bacon sandwich, then it’s a bacon sandwich with chilli. Gochujang is a great way to spice up plain old tomato ketchup – slather it on buttered bread, and make a bacon butty which will really blow away the cobwebs, and...
www.souschef.co.uk
Virus aside, who eats bacon sandwiches with chilly? As any hungover middle aged bastard knows, it's with greasy eggs.Flu virus with 'pandemic potential' found in China
The new strain, scientists say, is carried by pigs but can infect humans and requires close monitoring.www.bbc.co.uk
How To Cook the Best Bacon Sandwich - Korean Style!
What condiments go with a bacon sandwich? If there’s one thing better than a bacon sandwich, then it’s a bacon sandwich with chilli. Gochujang is a great way to spice up plain old tomato ketchup – slather it on buttered bread, and make a bacon butty which will really blow away the cobwebs, and...
Still growing:
www.washingtontimes.com
Tommy Robinson now 104,000 followers
Katie Hopkins 267,000 followers
Trump was kicked off Twitch for Hate speech
Sidney Powell's Twitter account has been suspended
Stefan Molyneux was kicked off of Youtube for promoting violence.
Something is going to happen soon.
Biden still hasn't nominated a running mate. I'm telling you, it's going to be Hillary.
There's a rumour going around that Trump is going to throw in the towel if his ratings go any lower.
Parler topples ‘tech tyrant’ Twitter in Apple ‘News App’ store
Parler, the emerging social media place for conservatives — particularly for those conservatives who’ve been caught by the self-righteous censors of Big Tech trap — has just toppled Twitter as the Number One “News App” on Apple’s app store. Call it the rebellion of the free speech advocates...
www.washingtontimes.com
Tommy Robinson now 104,000 followers
Katie Hopkins 267,000 followers
Trump was kicked off Twitch for Hate speech
Sidney Powell's Twitter account has been suspended
Stefan Molyneux was kicked off of Youtube for promoting violence.
Something is going to happen soon.
Biden still hasn't nominated a running mate. I'm telling you, it's going to be Hillary.
There's a rumour going around that Trump is going to throw in the towel if his ratings go any lower.
But not with tomato ketchup. Eggs - OK. Ketchup (or pretty much any tomato) - OK. Eggs + tomato = disgusting.